FAM81B

Ensembl ID:
ENSDARG00000035193
Description:
family with sequence similarity 81, member B [Source:HGNC Symbol;Acc:26335]
Human Orthologue:
FAM81B
Human Description:
family with sequence similarity 81, member B [Source:HGNC Symbol;Acc:26335]
Mouse Orthologue:
Fam81b
Mouse Description:
family with sequence similarity 81, member B Gene [Source:MGI Symbol;Acc:MGI:2685122]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8861 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10724 Essential Splice Site Available for shipment Available now
sa17631 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050979 Essential Splice Site 152 341 4 8
Genomic Location:
Chromosome 5 (position 52487992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAACAATGTGCAGAAATGACTGTTGCTTCGTAATGTATTGTCATTTTC[A/G]GCTGTCTCGGGACGTAGGAAAACTGGAGACRTCCCTGTCAGAGAAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050979 Essential Splice Site 232 341 5 8
Genomic Location:
Chromosome 5 (position 52497791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACACAGAACAGCCAGCAGCTGCAGACACTACTGCAGGACAGACTGG[T/A]AAACACATACAAACACATTNTGTGTNNNNNNNCAATTCCCRGTAAATGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050979 Nonsense 293 341 6 8
Genomic Location:
Chromosome 5 (position 52499194)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGAACATTCTRGAGAACAGCTTCAGAGAWGASCTAGAGCAGAWGAGA[A/T]RRGAATACCAGTCAGGTGAATCGAGCATATAAGCATCTCAATTATTAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/acc19o5d