fzd9a

Ensembl ID:
ENSDARG00000035185
ZFIN ID:
ZDB-GENE-060531-77
Description:
Novel protein similar to frizzled homolog 9 (Fzd9) [Source:UniProtKB/TrEMBL;Acc:A3QK10]
Human Orthologue:
FZD9
Human Description:
frizzled homolog 9 (Drosophila) [Source:HGNC Symbol;Acc:4047]
Mouse Orthologue:
Fzd9
Mouse Description:
frizzled homolog 9 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1313278]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26586 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050970 Nonsense 257 581 1 1
Genomic Location (Zv9):
Chromosome 5 (position 57435985)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 55356584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCATTCACAGTTCTAACCTTTCTCCTTGACCCCCAACGTTTTCAGTA[C/A]CCCGAGCGTCCAATCATCTTCCTCTCCATGTGTTACAACATCTACTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link