si:ch73-270f14.1

Ensembl ID:
ENSDARG00000035178
ZFIN IDs:
ZDB-GENE-040808-7, ZDB-GENE-081104-273
Description:
guanine nucleotide binding protein (G protein), alpha 14 [Source:RefSeq peptide;Acc:NP_001003753]
Human Orthologue:
GNA14
Human Description:
guanine nucleotide binding protein (G protein), alpha 14 [Source:HGNC Symbol;Acc:4382]
Mouse Orthologue:
Gna14
Mouse Description:
guanine nucleotide binding protein, alpha 14 Gene [Source:MGI Symbol;Acc:MGI:95769]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5322 Nonsense F2 line generated During 2017
sa20539 Nonsense Available for shipment Available now
sa7007 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20538 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5322
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018025   None 354 1 7
ENSDART00000134039 Nonsense 11 56 1 1
Genomic Location (Zv9):
Chromosome 5 (position 56938168)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54890694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACTGCCTAGTGAGCTGATGTATGCATTGACTGTGAAGTACTGGAGGTG[G/A]TTAAGACGGTTCAGGATGGAGGAGTGCTGTTTATCAGGYGAAGAAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018025 Nonsense 176 354 4 7
ENSDART00000134039   None 56 None 1
Genomic Location (Zv9):
Chromosome 5 (position 56926795)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54879321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACAGAATAGCTGCAGGGTTTTACATGCCGACCTTGCAGGATATTCTA[C/T]GAGTCCGAGTTCCAACCACAGGCATCATTGAATACGTCTTTGACCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018025 Essential Splice Site 241 354 6 7
ENSDART00000134039   None 56 None 1
Genomic Location (Zv9):
Chromosome 5 (position 56926441)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54878967
KASP Assay ID:
554-5159.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAACTTTGGATTTGAWTCTTTTTGTTTATAYGATGTTATTCCTCCAC[A/G]GAATCGAATGGAAGAAAGCAAGGCACTTTTTAAGACAATCATCTCCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018025 Nonsense 320 354 7 7
ENSDART00000134039   None 56 None 1
Genomic Location (Zv9):
Chromosome 5 (position 56921772)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54874298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTGAAAATGTATGAGGAACAGAACCCCGACAAACAGAAGCGGATCTA[T/A]GCACATTTTACCTGTGCGACTGACACTGAAAATATCCGTTTTGTTTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link