layna

Ensembl ID:
ENSDARG00000035169
ZFIN ID:
ZDB-GENE-070705-452
Description:
Novel protein similar to H.sapiens LAYN, layilin (LAYN) [Source:UniProtKB/TrEMBL;Acc:A5PN51]
Human Orthologue:
LAYN
Human Description:
layilin [Source:HGNC Symbol;Acc:29471]
Mouse Orthologue:
Layn
Mouse Description:
layilin Gene [Source:MGI Symbol;Acc:MGI:2685357]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2201 Nonsense Available for shipment Available now
sa1361 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050945 Nonsense 87 345 1 6
Genomic Location:
Chromosome 5 (position 59246861)
KASP Assay ID:
554-2516.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGCTGCGTAGGGATCAAGGGCGAGGCTATGAGGAGAATGGAAACTGTT[C/A]GTCTAAATACTACTGGATGGATGGAAGCCCAGCAACTTTCAGGTTGTACT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050945 Nonsense 325 345 6 6
Genomic Location:
Chromosome 5 (position 59235225)
KASP Assay ID:
554-1273.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCAGCACTGAGAGCGGCTTTGTGACCAATGATATGTACGACACGCTG[C/T]AAGGCCGAGGAAGCGGGAGATACTACAGAGACCAGGGCTGGATGGATGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qk81cy6t