si:ch211-239i4.3

Ensembl ID:
ENSDARG00000035161
ZFIN ID:
ZDB-GENE-081107-30
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B7ZDA5]
Human Orthologue:
PKDCC
Human Description:
protein kinase domain containing, cytoplasmic homolog (mouse) [Source:HGNC Symbol;Acc:25123]
Mouse Orthologue:
Pkdcc
Mouse Description:
protein kinase domain containing, cytoplasmic Gene [Source:MGI Symbol;Acc:MGI:2147077]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9725 Nonsense Available for shipment Available now
sa15357 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050934 Nonsense 310 516 3 7
ENSDART00000139183 Nonsense 78 160 2 3
Genomic Location (Zv9):
Chromosome 13 (position 2817222)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2994641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACRCTGCTGGACYTCAGGCCGCGGCAGTTCGTTCTGGTGGAYGGAGTGT[T/A]GAAGGTGACCGACCTGGACGACGCCAGTGTGGAGGAGACGCCCTGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050934 Nonsense 310 516 3 7
ENSDART00000139183 Nonsense 78 160 2 3
Genomic Location (Zv9):
Chromosome 13 (position 2817222)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2994641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACRCTGCTGGACYTCAGGCCGCGGCAGTTCGTTCTGGTGGAYGGAGTGT[T/A]GAAGGTGACCGACCTGGACGACGCCAGTGTGGAGGAGACGCCCTGCTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link