MCAM (1 of 3)

Ensembl ID:
ENSDARG00000035158
Description:
melanoma cell adhesion molecule [Source:HGNC Symbol;Acc:6934]
Human Orthologue:
MCAM
Human Description:
melanoma cell adhesion molecule [Source:HGNC Symbol;Acc:6934]
Mouse Orthologue:
Mcam
Mouse Description:
melanoma cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1933966]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18255 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074232 Nonsense 551 615 15 16
Genomic Location:
Chromosome 5 (position 60321482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGATAATAGTGGAGTGATTATTGTGGTGAKTATTGTAAGCAWCCTGT[T/A]GTTGGCAATCCTGGGCAGTGTTTTCTACTTCCTGTATAAAAAGGGCAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cs60bvx6