lrwd1

Ensembl ID:
ENSDARG00000035147
ZFIN ID:
ZDB-GENE-030131-5335
Description:
Novel protein (Wu:ft31b04) [Source:UniProtKB/TrEMBL;Acc:B0R160]
Human Orthologue:
LRWD1
Human Description:
leucine-rich repeats and WD repeat domain containing 1 [Source:HGNC Symbol;Acc:21769]
Mouse Orthologue:
Lrwd1
Mouse Description:
leucine-rich repeats and WD repeat domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918985]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14204 Nonsense Available for shipment Available now
sa16789 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050906 Nonsense 152 763 4 15

The following transcripts of ENSDARG00000035147 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 64550123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTSTAAANNGTGTTTTCTTGACYGCCTTTAGGTGATTGGTGTGTGGGAA[C/T]GAGACTTTAGTCTTCCTGATCCCATTTCAGCAWAAAGCCTTGCTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050906 Nonsense 163 763 4 15

The following transcripts of ENSDARG00000035147 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 64550156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTGGTGTGTGGGAAYGAGACTTTAGTCTTCCTGATCCCWTTTCAGCA[A/T]AAAGCCTTGCTGCTGTTGAGAAGAGCTTTGTTAACGCTGCCTGCACACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/11292w2j