lrwd1

Ensembl ID:
ENSDARG00000035147
ZFIN ID:
ZDB-GENE-030131-5335
Description:
Novel protein (Wu:ft31b04) [Source:UniProtKB/TrEMBL;Acc:B0R160]
Human Orthologue:
LRWD1
Human Description:
leucine-rich repeats and WD repeat domain containing 1 [Source:HGNC Symbol;Acc:21769]
Mouse Orthologue:
Lrwd1
Mouse Description:
leucine-rich repeats and WD repeat domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918985]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14204 Nonsense Available for shipment Available now
sa16789 Nonsense Available for shipment Available now
sa26601 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa14204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050906 Nonsense 152 763 4 15

The following transcripts of ENSDARG00000035147 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 64550123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTSTAAANNGTGTTTTCTTGACYGCCTTTAGGTGATTGGTGTGTGGGAA[C/T]GAGACTTTAGTCTTCCTGATCCCATTTCAGCAWAAAGCCTTGCTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16789
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050906 Nonsense 163 763 4 15

The following transcripts of ENSDARG00000035147 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 64550156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTGGTGTGTGGGAAYGAGACTTTAGTCTTCCTGATCCCWTTTCAGCA[A/T]AAAGCCTTGCTGCTGTTGAGAAGAGCTTTGTTAACGCTGCCTGCACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050906 Essential Splice Site 194 763 4 15

The following transcripts of ENSDARG00000035147 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 64550253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGTCAAGTATGGCCCCAATTCCTTGAGTGATTACACAAAGTGGAGGG[T/C]CAGTATTATGTGAATGTTGTGTTCCTGAGACAGATTTTAAGTTTATAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/11292w2j