si:dkey-197m14.2

Ensembl ID:
ENSDARG00000035137
ZFIN ID:
ZDB-GENE-060531-86
Human Orthologue:
EHD2
Human Description:
EH-domain containing 2 [Source:HGNC Symbol;Acc:3243]
Mouse Orthologue:
Ehd2
Mouse Description:
EH-domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2154274]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20565 Nonsense Available for shipment Available now
sa45230 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050885 Nonsense 188 546 4 6
Genomic Location (Zv9):
Chromosome 5 (position 65045722)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61321212
GRCz11 5 61983949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTTATCCGCTGGTTTGCGGAGCACGTAGACCGGATCATCCTCCTGTG[T/A]GATGCACACAAGCTGGAGATTTCTGATGAGTTTTCCCGCACTATACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050885 Nonsense 507 546 6 6
Genomic Location (Zv9):
Chromosome 5 (position 65054075)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61329565
GRCz11 5 61992302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGCAGATGTGGATTGTGATGGTAAGTTGGACGATGAGGAGTTTGCTT[T/A]GGCCGGTCATCTCATTGAGGTAAAGTTGGAAGGTTTTGGGCTTCCTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link