pho

Ensembl ID:
ENSDARG00000035133
ZFIN ID:
ZDB-GENE-030131-5935
Description:
Hi43 [Source:UniProtKB/TrEMBL;Acc:Q6DRQ0]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa921 Essential Splice Site Available for shipment Available now
sa38518 Nonsense Mutation detected in F1 DNA During 2017
sa38519 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa921
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050879 Essential Splice Site 62 925 1 5
ENSDART00000122857 Essential Splice Site 62 908 1 8
ENSDART00000130177 Essential Splice Site 62 766 1 6
Genomic Location (Zv9):
Chromosome 5 (position 65379271)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61656848
KASP Assay ID:
554-0827.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGAAGATAAGAAGAGACCCGTCTGTGCACAGCCCTCCTTCAGACAGG[T/C]AAGAAAAGAYTTGTAGCTACTAGTTAATGGTATTCGTAAATGTTTGCAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050879 Nonsense 562 925 5 5
ENSDART00000122857 Nonsense 562 908 5 8
ENSDART00000130177 Nonsense 562 766 5 6
Genomic Location (Zv9):
Chromosome 5 (position 65387849)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61666244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTAAGCCAAGAACACCAAACAAACAGTTTACCAGTACTAAACACCCT[G/T]AAATCCCACAGTTTAGAGTTCAGAGTCCAAAACCACCCTCAAGGCAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050879 Nonsense 698 925 5 5
ENSDART00000122857 Nonsense 687 908 6 8
ENSDART00000130177 Nonsense 698 766 5 6
Genomic Location (Zv9):
Chromosome 5 (position 65388257)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 61666652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAGCATGTGGAGTGGAACATGAAATGGCAATTGGAGAACAAACCGAA[G/T]AATTGGGTTTAAAGTCAAAGGAGCTCTTGGAGGAAAGTGTTTTATCTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link