rxrab

Ensembl ID:
ENSDARG00000035127
ZFIN ID:
ZDB-GENE-990415-243
Description:
Retinoic acid receptor RXR-alpha-B [Source:UniProtKB/Swiss-Prot;Acc:Q90415]
Human Orthologue:
RXRA
Human Description:
retinoid X receptor, alpha [Source:HGNC Symbol;Acc:10477]
Mouse Orthologue:
Rxra
Mouse Description:
retinoid X receptor alpha Gene [Source:MGI Symbol;Acc:MGI:98214]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16874 Nonsense Available for shipment Available now
sa1205 Nonsense F2 line generated During 2014
sa11783 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16874
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016321 Nonsense 96 379 3 9
Genomic Location:
Chromosome 5 (position 68079030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACGGTCAGAAAGGAYCTGACGTACACTTGCAGAGACAACAAGGACTG[T/A]ATGATCGAMAAACGCCAACGCAACCGATGCCAGTACTGCCGCTAWCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1205
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016321 Nonsense 111 379 3 9
Genomic Location:
Chromosome 5 (position 68078985)
KASP Assay ID:
554-1114.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGTATGATCGACAAACGCCAACGCAACCGATGCCAGTACTGCCGCTA[T/A]CAGAAGTGCTTAGCCATGGGGATGAAGAGAGAAGGTGYGTCCGTTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016321 Essential Splice Site 331 379 9 9
Genomic Location:
Chromosome 5 (position 68054132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATCAGTGTTGTTTTGCCTAATATTCTCTGTAATATTTAAAAWTCGYGC[A/T]GRTTTGCCAAGCTGCTGCTGCGTCTGCCCGCCCTGCGCTCCATCGGCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0paxzqsm