brd3b

Ensembl ID:
ENSDARG00000035126
ZFIN ID:
ZDB-GENE-030131-5316
Description:
bromodomain-containing protein 3 [Source:RefSeq peptide;Acc:NP_997867]
Human Orthologue:
BRD3
Human Description:
bromodomain containing 3 [Source:HGNC Symbol;Acc:1104]
Mouse Orthologue:
Brd3
Mouse Description:
bromodomain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1914632]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9154 Nonsense Mutation detected in F1 DNA During 2014
sa1777 Nonsense Available for shipment Available now
sa2227 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa9154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043638 Nonsense 250 728 7 14
ENSDART00000050861 Nonsense 249 662 7 12
ENSDART00000132713 None None 68 None 2

The following transcripts of ENSDARG00000035126 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 68016604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAACCTGCGCGATCACTGCCAGCCGAAGTGAGTCGCCTACTGCRATGT[T/A]GGAGTCCAAAYACAGTAAAGTCATTTCCAGAYGAGAGAGCACAGGTCGRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043638 Nonsense 261 728 7 14
ENSDART00000050861 Nonsense 260 662 7 12
ENSDART00000132713 None None 68 None 2

The following transcripts of ENSDARG00000035126 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 68016572)
KASP Assay ID:
554-1770.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCGCCTACTGCAATGTTGGAGTCCAAACACAGTAAAGTCATTTCCAGA[C/T]GAGAGAGCACAGGTCGRCCCATTAAACCTCCCAAGAAGGACCTGGAGGAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2227
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043638 Essential Splice Site 473 728 10 14
ENSDART00000050861 None None 662 None 12
ENSDART00000132713 None None 68 None 2

The following transcripts of ENSDARG00000035126 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 68006498)
KASP Assay ID:
554-2898.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGGTAACAGGGCGGGGACAAAAAACGGGTGTGCCAAACGTTTTCAGG[T/G]GAATGATATTTTTACTTCCCGGTCCCCCACCCCACTAACTCCTCCATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dz8qr3iq