camsap1b

Ensembl ID:
ENSDARG00000035122
ZFIN ID:
ZDB-GENE-070705-301
Description:
Calmodulin-regulated spectrin-associated protein 1-B [Source:UniProtKB/Swiss-Prot;Acc:A5WUN7]
Human Orthologue:
CAMSAP1
Human Description:
calmodulin regulated spectrin-associated protein 1 [Source:HGNC Symbol;Acc:19946]
Mouse Orthologue:
Camsap1
Mouse Description:
calmodulin regulated spectrin-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:3036242]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16582 Essential Splice Site Available for shipment Available now
sa2217 Nonsense F2 line generated During 2016
sa33754 Nonsense Mutation detected in F1 DNA During 2016
sa20574 Nonsense Mutation detected in F1 DNA During 2016
sa17585 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082776 Essential Splice Site 439 1558 10 18
ENSDART00000147707 Essential Splice Site 439 1558 11 19
Genomic Location (Zv9):
Chromosome 5 (position 68612774)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64944996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACTGAGACAAAGACAGAAGAAAGCTCAGCCAGCAGAGGAAAGCACGG[G/T]TATTRAATCAAACTATGGCCATTCARTTCAAATATGTWTTTATGCTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2217
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082776 Nonsense 444 1558 11 18
ENSDART00000147707 Nonsense 444 1558 12 19
Genomic Location (Zv9):
Chromosome 5 (position 68611159)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64943381
KASP Assay ID:
554-2754.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTAATCRAATTATCTGTGTTGTGCTTTTCTTACCAGCYTGTCGAAAT[C/T]GATCTAATTCATTGACGCAAGAAGGTCATCCCAGAGGATCTGTGGCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082776 Nonsense 638 1558 12 18
ENSDART00000147707 Nonsense 638 1558 13 19
Genomic Location (Zv9):
Chromosome 5 (position 68610453)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64942675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGTCAACTCGGAGAGTGGCTGGAGCAGAAAGTGCTGCTTCATCTACA[C/T]GACGGAGACCTCCACAAACTCTCAACCGAACTTTTACCCCTAACACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082776 Nonsense 861 1558 12 18
ENSDART00000147707 Nonsense 861 1558 13 19
Genomic Location (Zv9):
Chromosome 5 (position 68609784)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64942006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACACCACAGAACAAGGACAATGCCAACATGCTGGCATCGGAACTTGTT[C/T]AACTCCACATGCAACTTGAAGAAAAGAGACGTGCAATTGAATCCCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082776 Essential Splice Site 1274 1558 13 18
ENSDART00000147707 Essential Splice Site 1274 1558 14 19
Genomic Location (Zv9):
Chromosome 5 (position 68607442)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64939664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYAAGCAACAACTGGAGGCTGAAAGTGAGCAGAAAAGAGATGAAACCAGG[T/C]AATGGATAAAGTCTGGTCCTTTAGGAAKATAAAAAYGGAGGGNAAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link