CASK (2 of 2)

Ensembl ID:
ENSDARG00000035103
Description:
calcium/calmodulin-dependent serine protein kinase (MAGUK family) [Source:HGNC Symbol;Acc:1497]
Human Orthologue:
CASK
Human Description:
calcium/calmodulin-dependent serine protein kinase (MAGUK family) [Source:HGNC Symbol;Acc:1497]
Mouse Orthologue:
Cask
Mouse Description:
calcium/calmodulin-dependent serine protein kinase (MAGUK family) Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8253 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083554 Nonsense 61 780 2 34
Genomic Location:
Chromosome 6 (position 59516861)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCYAGAGGTGGTGAAGCGGGAGCCGTACGGGAAGCCGGTGGACGTGTG[G/A]GGCTGCGGGGTCATTCTCTTCATCCTGCTCAGCGGATGCCTGCCCTTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o83y09bq