si:ch211-237a6.7

Ensembl ID:
ENSDARG00000035080
ZFIN ID:
ZDB-GENE-030131-1458
Human Orthologue:
HSF2BP
Human Description:
heat shock transcription factor 2 binding protein [Source:HGNC Symbol;Acc:5226]
Mouse Orthologue:
Hsf2bp
Mouse Description:
heat shock transcription factor 2 binding protein Gene [Source:MGI Symbol;Acc:MGI:1921627]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14014 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075546 Essential Splice Site 96 347 3 8
ENSDART00000133246 Essential Splice Site 99 365 3 9

The following transcripts of ENSDARG00000035080 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 28068353)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28333911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAACCAGAMTAGATGCTGCCCTGAATGAGTGTCAGAATGAGAAACAGG[T/C]ACTATAACAGAAAGGATGAGAGACTGCAGAGACCACACTGAAGTGAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link