pfdn5

Ensembl ID:
ENSDARG00000035043
ZFIN ID:
ZDB-GENE-030131-6858
Description:
prefoldin subunit 5 [Source:RefSeq peptide;Acc:NP_001104665]
Human Orthologue:
PFDN5
Human Description:
prefoldin subunit 5 [Source:HGNC Symbol;Acc:8869]
Mouse Orthologue:
Pfdn5
Mouse Description:
prefoldin 5 Gene [Source:MGI Symbol;Acc:MGI:1928753]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40747 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049722 Nonsense 127 153 5 6

The following transcripts of ENSDARG00000035043 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 39595692)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39667292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAAATTGAAAAGATTCAGCCTGCTCTTCAAGAAAAATATGCCATGAAA[C/T]AAGGTGATTTTCTTGTCTTTTGAAAAACATGTTTCTTATGTTCACCATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link