lpcat4

Ensembl ID:
ENSDARG00000035028
ZFIN ID:
ZDB-GENE-030131-5777
Description:
lysophospholipid acyltransferase LPCAT4 [Source:RefSeq peptide;Acc:NP_991122]
Human Orthologue:
LPCAT4
Human Description:
lysophosphatidylcholine acyltransferase 4 [Source:HGNC Symbol;Acc:30059]
Mouse Orthologue:
Lpcat4
Mouse Description:
lysophosphatidylcholine acyltransferase 4 Gene [Source:MGI Symbol;Acc:MGI:2138993]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38589 Nonsense Mutation detected in F1 DNA During 2017
sa40820 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050687 Nonsense 182 508 3 13
Genomic Location (Zv9):
Chromosome 7 (position 1664135)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1347454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGTGCGTGTCTCAGATCTGTGAGAGAGTGACGTCTGATGGACACT[G/A]GCCTCAGGTATGAACGCGCGCATACACACACACCAACCTACTCAATCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050687 Nonsense 182 508 3 13
Genomic Location (Zv9):
Chromosome 7 (position 1664136)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1347455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGTGCGTGTCTCAGATCTGTGAGAGAGTGACGTCTGATGGACACTG[G/A]CCTCAGGTATGAACGCGCGCATACACACACACCAACCTACTCAATCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link