retsatl

Ensembl ID:
ENSDARG00000034989
ZFIN ID:
ZDB-GENE-051113-252
Description:
retinol saturase-like [Source:RefSeq peptide;Acc:NP_001035093]
Human Orthologue:
RETSAT
Human Description:
retinol saturase (all-trans-retinol 13,14-reductase) [Source:HGNC Symbol;Acc:25991]
Mouse Orthologue:
Retsat
Mouse Description:
retinol saturase (all trans retinol 13,14 reductase) Gene [Source:MGI Symbol;Acc:MGI:1914692]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11225 Nonsense Available for shipment Available now
sa10711 Nonsense Available for shipment Available now
sa21592 Nonsense Mutation detected in F1 DNA During 2014
sa21593 Nonsense Mutation detected in F1 DNA During 2014
sa21594 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 3 607 1 11
ENSDART00000141434 Nonsense 3 604 1 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 46061767)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAAATTCAAAGTTACAGNYYTTTTCTGCCAKTGATTGAAGATGTGGTG[G/A]MTTTTGYTGTTCTTAGAATGGTTTGTAGACTGGGCTCRYGGCACATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10711
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 231 607 4 11
ENSDART00000141434 Nonsense 231 604 4 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 46063328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCGCTTYATATTGAGGACTGGAATTGCTGACTTTATTTCCCCAATTT[T/A]AAAATAYTCCCGCACCAGTACATCAGAGGTGGTCAAGTCTCTYACCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 288 607 5 11
ENSDART00000141434 Nonsense 285 604 5 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 46063598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGATTGATGCCCTCCTCCTACACCACTCAAAGCGTGGTGTGTACTA[T/A]CCTCAGGGTGGTGCTAGTGAAATCCCGTATCATATCATCCAGGTTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Nonsense 386 607 7 11
ENSDART00000141434 Nonsense 383 604 7 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 46064276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGTCCAGGAATATCTTAAAGCTCTGAAACCAGGCAAAGGCTTTTTT[C/T]AAGTATTTGCTGGCTTCAATGCCACAATGGAAGAACTAGGCATCTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043899 Essential Splice Site 416 607 None 11
ENSDART00000141434 Essential Splice Site 413 604 None 11

The following transcripts of ENSDARG00000034989 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 46064446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTATCTATTCTTCCTGCTAGTTCTTACTTTATTTTTCCGTTCCCTGT[A/G]GGATGGAGGAGTACTTTGCTTCAGACAAGCAAGATGCACCTGATAATGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sb9fc633