bzw1b

Ensembl ID:
ENSDARG00000034961
ZFIN ID:
ZDB-GENE-040426-2881
Description:
Basic leucine zipper and W2 domain-containing protein 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q803N9]
Human Orthologue:
BZW1
Human Description:
basic leucine zipper and W2 domains 1 [Source:HGNC Symbol;Acc:18380]
Mouse Orthologue:
Bzw1
Mouse Description:
basic leucine zipper and W2 domains 1 Gene [Source:MGI Symbol;Acc:MGI:1914132]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41323 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011540 Nonsense 334 418 10 12

The following transcripts of ENSDARG00000034961 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 52185)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 432325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTTTTGTCTTCAGCAACACAGTCCTCTTCTGAAGGCCTTCAGCACA[C/T]AGGCTCAGTCTGAGCTCTCGCTGCTGCAGAGGATCCAGGAGTTCTGCTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link