GIMAP8 (87 of 111)

Ensembl ID:
ENSDARG00000034946
Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20003 Nonsense Mutation detected in F1 DNA During 2014
sa20002 Nonsense Available for shipment Available now
sa9254 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103953 Nonsense 37 436 1 4
Genomic Location:
Chromosome 3 (position 24967058)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTAGCGTACAACGCTTTTAAATCGGACATGCAGCTGAGCAGAGTTACA[C/T]AATTCTGTGACAAAGCATCTGGAAACATCGGTGGTCGACCTGTGGCCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103953 Nonsense 246 436 4 4
Genomic Location:
Chromosome 3 (position 24954964)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAGTGGGAGCAAGAGGATCTGGAAAAAGCTCAACTGGAAACACCATTT[T/A]AAGGTGGAACGCCTTCAACACGGACATGCAGCTGAGCAGGGTCACGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103953 Nonsense 416 436 4 4
Genomic Location:
Chromosome 3 (position 24954454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATYGACACCTTGGTGGCTGTCAACGGCGGAAGCTGCTACACTACGT[C/A]ATTTTACCCGGCCTCMRAGAAGAAGATACGCGAAAAACAAGAGAAGATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ilggwudd