LOC558202

Ensembl ID:
ENSDARG00000034943
Mouse Orthologue:
Gm364
Mouse Description:
predicted gene 364 Gene [Source:MGI Symbol;Acc:MGI:2685210]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13642 Essential Splice Site Available for shipment Available now
sa10765 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039880 Essential Splice Site 102 653 5 18
Genomic Location (Zv9):
Chromosome 14 (position 32736279)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31526086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGATGAWCGAATCAATCAAATTCTGAMCTATAAATTTTCCTCCTA[G/A]TTTTTGTTTATGAATGACTTGACATGCCARAAGGTTTGCACRAAATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039880 Essential Splice Site 574 653 16 18
Genomic Location (Zv9):
Chromosome 14 (position 32745575)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31535382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCTGAGGCCACTGTTCTGCTCTGCTACTTTCATTTATGTGCAGAGG[T/G]RAGACTGATTTTTGTCAGATGTGAAATTTTATATTTTTATARCCTATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link