LOC558202

Ensembl ID:
ENSDARG00000034943
Mouse Orthologue:
Gm364
Mouse Description:
predicted gene 364 Gene [Source:MGI Symbol;Acc:MGI:2685210]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13642 Essential Splice Site Available for shipment Available now
sa2771 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10765 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039880 Essential Splice Site 102 653 5 18
Genomic Location:
Chromosome 14 (position 32736279)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGATGAWCGAATCAATCAAATTCTGAMCTATAAATTTTCCTCCTA[G/A]TTTTTGTTTATGAATGACTTGACATGCCARAAGGTTTGCACRAAATCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039880 Essential Splice Site 413 653 12 18
Genomic Location:
Chromosome 14 (position 32743069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCTTCTTGGCACRCCTGCTGGATATGTKTCTTCCAGACTCTATAAGA[G/A]TAAGAATATATTGCAAGGNAAATTTATTTTAATCATTTCWAAGRTGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039880 Essential Splice Site 574 653 16 18
Genomic Location:
Chromosome 14 (position 32745575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCTGAGGCCACTGTTCTGCTCTGCTACTTTCATTTATGTGCAGAGG[T/G]RAGACTGATTTTTGTCAGATGTGAAATTTTATATTTTTATARCCTATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yq4plowg