cx52.6

Ensembl ID:
ENSDARG00000034930
ZFIN ID:
ZDB-GENE-040310-6
Description:
connexin 52.6 [Source:RefSeq peptide;Acc:NP_997984]
Human Orthologues:
GJA10, GJA9
Human Descriptions:
gap junction protein, alpha 10, 62kDa [Source:HGNC Symbol;Acc:16995]
gap junction protein, alpha 9, 59kDa [Source:HGNC Symbol;Acc:19155]
Mouse Orthologue:
Gja10
Mouse Description:
gap junction protein, alpha 10 Gene [Source:MGI Symbol;Acc:MGI:1339969]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu2504 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu2504
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042123 Nonsense 329 466 1 1
ENSDART00000121815 Nonsense 329 474 1 2
Genomic Location:
Chromosome 20 (position 23943849)
KASP Assay ID:
554-0065.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGTGCAGCCTCTGAGACAGGACCGTCTTCCAAGCCAACCCGAAATT[C/T]AAGTTCTTCAACAACTGGGAATCAAAGAACGAAGGTCCATTCCAGACAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y4ykkppp