tgfb1b

Ensembl ID:
ENSDARG00000034895
ZFIN ID:
ZDB-GENE-091028-1
Human Orthologue:
TGFB1
Human Description:
transforming growth factor, beta 1 [Source:HGNC Symbol;Acc:11766]
Mouse Orthologue:
Tgfb1
Mouse Description:
transforming growth factor, beta 1 Gene [Source:MGI Symbol;Acc:MGI:98725]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3109 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3109
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028981 Nonsense 51 387 1 9
ENSDART00000134907 Nonsense 51 379 1 7
Genomic Location:
Chromosome 21 (position 20508386)
KASP Assay ID:
554-2500.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGAGAAAGCGCATCGAAGCCATTCGTGGACAGATTCTCAGCAAACTA[C/T]GACTGCCCAAGGAACCAGAAGTAGAAGAGAAGGAGTTGATTGAAAACATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u1a7ukjo