rarab

Ensembl ID:
ENSDARG00000034893
ZFIN ID:
ZDB-GENE-980526-72
Description:
Retinoic acid receptor alpha-B [Source:UniProtKB/Swiss-Prot;Acc:Q7ZTI3]
Human Orthologue:
RARA
Human Description:
retinoic acid receptor, alpha [Source:HGNC Symbol;Acc:9864]
Mouse Orthologue:
Rara
Mouse Description:
retinoic acid receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:97856]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20058 Nonsense Available for shipment Available now
sa20057 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044677 Nonsense 173 458 4 8
ENSDART00000126022 Nonsense 175 460 4 8
Genomic Location (Zv9):
Chromosome 3 (position 33206855)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32938165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAACAAAAGGAAGAAAGACGACAAGAAGCAAGAATGTTTGGAAAATTA[C/A]GTCTTAAGTCCAGATACGGAGAAGATGATCGAGCAGGTGAGGAAGGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044677 Essential Splice Site 333 458 6 8
ENSDART00000126022 Essential Splice Site 335 460 6 8
Genomic Location (Zv9):
Chromosome 3 (position 33206184)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32937494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGATGCAGAGACTGGGCTTCTTAGCGCCATCTGTCTGCTGTGTGGAGG[T/C]ACTGCAGCTTTAGACACATTTATTTTTTTAATCTTGTTTCAATTTGTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link