bet1

Ensembl ID:
ENSDARG00000034885
ZFIN ID:
ZDB-GENE-040625-3
Description:
BET1 homolog [Source:RefSeq peptide;Acc:NP_001002046]
Human Orthologue:
BET1
Human Description:
blocked early in transport 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:14562]
Mouse Orthologue:
Bet1
Mouse Description:
blocked early in transport 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1343104]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29255 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004514 Essential Splice Site 43 113 2 4
Genomic Location (Zv9):
Chromosome 19 (position 41863884)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41316138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACATCTACAGGAGGGACTGAGAGATAAAGTACACGCACTTAAACACG[T/C]GAGTGGCCTTCATATCTGATGCTCTATTTTGATTAACTACTCTGCATAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging: Linkage and association of successful aging to the 6q25 region in large Amish kindreds. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link