mid2

Ensembl ID:
ENSDARG00000034871
ZFIN ID:
ZDB-GENE-090220-1
Human Orthologues:
TRIM36, TRIM46
Human Descriptions:
tripartite motif-containing 36 [Source:HGNC Symbol;Acc:16280]
tripartite motif-containing 46 [Source:HGNC Symbol;Acc:19019]
Mouse Orthologues:
Trim36, Trim46
Mouse Descriptions:
tripartite motif-containing 36 Gene [Source:MGI Symbol;Acc:MGI:106264]
tripartite motif-containing 46 Gene [Source:MGI Symbol;Acc:MGI:2673000]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5871 Nonsense Mutation detected in F1 DNA During 2014
sa700 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003293 Nonsense 47 429 2 7
Genomic Location:
Chromosome 14 (position 29366839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGYTTAGGTGATGAAGCTGAGGAAGTTGGCTCAGCAGATTGCGAACTGC[A/T]GACAGTGTCTGGAGCGCTCGAGCGCCCTCATCACACAGGCGGAGCACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003293 Nonsense 303 429 7 7
Genomic Location:
Chromosome 14 (position 29405306)
KASP Assay ID:
554-0608.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGTTKTTCATCTGTTTCCCCTTCAGGTACGCTCTTGGTGTGGCCTA[T/A]AAGTCAGCACCCAAAAACGAGTGGAGTGGTAAAAACTCATCATCTTGGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4g6l9kpp