nt5c2l1

Ensembl ID:
ENSDARG00000034852
ZFIN ID:
ZDB-GENE-031006-8
Description:
5'-nucleotidase, cytosolic II, like 1 [Source:RefSeq peptide;Acc:NP_001004549]
Human Orthologue:
NT5DC4
Human Description:
5'-nucleotidase domain containing 4 [Source:HGNC Symbol;Acc:27678]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9485 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007961 Essential Splice Site 139 518 5 18
ENSDART00000137905 Essential Splice Site 139 507 5 18
ENSDART00000147794   None 239 None 7

The following transcripts of ENSDARG00000034852 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17506356)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17518702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGACACTGACCGATTTTACGTCCTCAATACACTCTTCAACCTCTCAG[G/A]TACAATAACAGTGACACATTTACATGGTCATCTGATGGATGATCATTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link