ENSDARG00000034836

Ensembl ID:
ENSDARG00000034836
Human Orthologues:
KRT7, KRT81, KRT82, KRT83, KRT84, KRT85, KRT86
Human Descriptions:
keratin 7 [Source:HGNC Symbol;Acc:6445]
keratin 81 [Source:HGNC Symbol;Acc:6458]
keratin 82 [Source:HGNC Symbol;Acc:6459]
keratin 83 [Source:HGNC Symbol;Acc:6460]
keratin 84 [Source:HGNC Symbol;Acc:6461]
keratin 85 [Source:HGNC Symbol;Acc:6462]
keratin 86 [Source:HGNC Symbol;Acc:6463]
Mouse Orthologues:
4732456N10Rik, 5430421N21Rik, Krt7, Krt81, Krt82, Krt83, Krt84, Krt86
Mouse Descriptions:
keratin 7 Gene [Source:MGI Symbol;Acc:MGI:96704]
keratin 81 Gene [Source:MGI Symbol;Acc:MGI:1928858]
keratin 82 Gene [Source:MGI Symbol;Acc:MGI:2149248]
keratin 83 Gene [Source:MGI Symbol;Acc:MGI:3665486]
keratin 84 Gene [Source:MGI Symbol;Acc:MGI:96700]
keratin 86 Gene [Source:MGI Symbol;Acc:MGI:109362]
RIKEN cDNA 4732456N10 gene Gene [Source:MGI Symbol;Acc:MGI:3045312]
RIKEN cDNA 5430421N21 gene Gene [Source:MGI Symbol;Acc:MGI:3690448]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25387 Nonsense Mutation detected in F1 DNA During 2014
sa9896 Essential Splice Site Available for shipment Available now
sa14026 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045669 Nonsense 91 376 2 8
Genomic Location:
Chromosome 8 (position 7662774)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTGAAACACTGGCAGGTTCGCAAACTAGAGCAGGAGAACAAGCTTT[T/A]GGAGACCAAATGGCGACTACTACAGAAAGAGACTAAAGCGGAGTCTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045669 Essential Splice Site 150 376 2 8
Genomic Location:
Chromosome 8 (position 7662596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAACGAGCTCAGAAAAGCCCAYGCACAGGTCCAGGAGCAAAAGCAGAG[G/T]TATGTATAGTYGCATCTGCTGAAAACTACAGTTCAGTTTATCATCATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045669 Nonsense 334 376 7 8
Genomic Location:
Chromosome 8 (position 7656281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRGTGCTTGATGCCACYGAGCAAATCCGCCTGCTGGAGGAAGCACTGCAG[A/T]AAGCCAAAAAGGAAATGGCCAGACAGCTTAGAGATTACCAGGAGCTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0lpo41ap