copg2

Ensembl ID:
ENSDARG00000034823
ZFIN ID:
ZDB-GENE-000208-8
Description:
Coatomer subunit gamma-2 [Source:UniProtKB/Swiss-Prot;Acc:Q9PUE4]
Human Orthologue:
COPG2
Human Description:
coatomer protein complex, subunit gamma 2 [Source:HGNC Symbol;Acc:2237]
Mouse Orthologue:
Copg2
Mouse Description:
coatomer protein complex, subunit gamma 2 Gene [Source:MGI Symbol;Acc:MGI:1858683]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33433 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30848 Nonsense Mutation detected in F1 DNA During 2017
sa40262 Nonsense Mutation detected in F1 DNA During 2017
sa30609 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043660 Essential Splice Site 81 873 4 23

The following transcripts of ENSDARG00000034823 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 15050313)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15986166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCACTGAAGCTTTCTTTGCCATGACAAGGCTGTTCCAGTCTAATGAT[G/T]TAAGAAATTGACGTTCATTTAGTTTTTTTTTTTTTTTTTTTTTTTTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30848
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043660 Nonsense 142 873 7 23
ENSDART00000043660 Nonsense 142 873 7 23

The following transcripts of ENSDARG00000034823 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 15051574)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15987427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCTTCTTCCAACCGTTCCGTCAGACCACAATGTTGCAGGCTATTGAA[C/T]GATACATGAAACAGGCCATTGTGGACAAAGTGCCCAGCGTCTCCAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043660 Nonsense 142 873 7 23
ENSDART00000043660 Nonsense 142 873 7 23

The following transcripts of ENSDARG00000034823 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 15051574)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15987427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCTTCTTCCAACCGTTCCGTCAGACCACAATGTTGCAGGCTATTGAA[C/T]GATACATGAAACAGGCCATTGTGGACAAAGTGCCCAGCGTCTCCAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043660 Essential Splice Site 408 873 13 23

The following transcripts of ENSDARG00000034823 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 15055061)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15990914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCACAGCGTAATGATGAACTTTCTCTCAAACATGCTGCGAGACGATG[T/C]AAGTTCATTTAAGGACGTTTGTTCCTGTGGTTTCTTTTGCCGAATCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link