asah1b

Ensembl ID:
ENSDARG00000034817
ZFIN ID:
ZDB-GENE-040426-1512
Description:
N-acylsphingosine amidohydrolase [Source:RefSeq peptide;Acc:NP_956871]
Human Orthologue:
ASAH1
Human Description:
N-acylsphingosine amidohydrolase (acid ceramidase) 1 [Source:HGNC Symbol;Acc:735]
Mouse Orthologue:
Asah1
Mouse Description:
N-acylsphingosine amidohydrolase 1 Gene [Source:MGI Symbol;Acc:MGI:1277124]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19461 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040434 Essential Splice Site 101 395 4 14
Genomic Location:
Chromosome 1 (position 15404062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCTTTGTTCCCAGCGGGAAGCTCATTCAGCTGGTGGACAAGGACTTGG[T/A]GAATATTAACAATCTAACACATCTCTTTGCACACTGTAAAACCCAATAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a2iyp9mh