kcnip1b

Ensembl ID:
ENSDARG00000034808
ZFIN ID:
ZDB-GENE-041212-57
Description:
Kv channel interacting protein 1 b [Source:RefSeq peptide;Acc:NP_001008632]
Human Orthologue:
KCNIP1
Human Description:
Kv channel interacting protein 1 [Source:HGNC Symbol;Acc:15521]
Mouse Orthologue:
Kcnip1
Mouse Description:
Kv channel-interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917607]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21722 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12212 Essential Splice Site Available for shipment Available now
sa15042 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035188 Essential Splice Site 62 215 3 8
ENSDART00000109420 Essential Splice Site 62 215 3 8
ENSDART00000035188 Essential Splice Site 62 215 3 8
ENSDART00000109420 Essential Splice Site 62 215 3 8
Genomic Location:
Chromosome 10 (position 22226069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAAAAATGAGTCTCGTAGCAATATTATGACCTGTTTGTTTTCCCCCAC[A/T]GGAGTGTCCAAGTGGAGTGGTGAATGAGGACACTTTTAAACACATTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035188 Essential Splice Site 62 215 3 8
ENSDART00000109420 Essential Splice Site 62 215 3 8
ENSDART00000035188 Essential Splice Site 62 215 3 8
ENSDART00000109420 Essential Splice Site 62 215 3 8
Genomic Location:
Chromosome 10 (position 22226069)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAAAATGAGTCTCGTAGCAATATTATGACCTGTTTGTTTTCCCCCAC[A/C]GGAGTGTCCAAGTGGAGTGGTGAATGAGGACACTTTTAAACACWTTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15042
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035188 Nonsense 187 215 7 8
ENSDART00000109420 Nonsense 187 215 7 8
Genomic Location:
Chromosome 10 (position 22229181)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCTAAATACAYTTTCACTCTTTCACAGAAAATGGACAAAAACAAAGAT[G/T]GAGTTGTAACATTGGAGGAGTTTGWCCTTGCCTGCCAAGAGGTACWTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fezx997c