ncapd3

Ensembl ID:
ENSDARG00000034773
ZFIN ID:
ZDB-GENE-040426-737
Description:
condensin-2 complex subunit D3 [Source:RefSeq peptide;Acc:NP_956624]
Human Orthologue:
NCAPD3
Human Description:
non-SMC condensin II complex, subunit D3 [Source:HGNC Symbol;Acc:28952]
Mouse Orthologue:
Ncapd3
Mouse Description:
non-SMC condensin II complex, subunit D3 Gene [Source:MGI Symbol;Acc:MGI:2142989]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16819 Essential Splice Site Available for shipment Available now
sa8666 Nonsense Mutation detected in F1 DNA During 2017
sa39601 Nonsense Mutation detected in F1 DNA During 2017
sa38260 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11112 Nonsense Available for shipment Available now
sa32655 Nonsense Mutation detected in F1 DNA During 2017
sa38259 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049572 Essential Splice Site 288 1419 7 35

The following transcripts of ENSDARG00000034773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20341983)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20866394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGGACTGGGGTTGCTTTGCTCTACTGTTCATGGTGAAGGYGATGAG[G/T]TGGGTAAAGTTACTCCAAAAAGATCTYYATGTTTTGGTTGCATATATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049572 Nonsense 292 1419 8 35

The following transcripts of ENSDARG00000034773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20341888)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20866299
KASP Assay ID:
2259-0496.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATCTTGTATTGCTTRATCATTGTGGCTGCATTTTACAGTGCCGTCGC[A/T]GAGTGTTTCGCAAGCTACTTTATGTGATTCTWATGATGAAAACACAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049572 Nonsense 692 1419 17 35

The following transcripts of ENSDARG00000034773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20336584)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20860995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCCTCTGTAGCCGGTATTTCAGTAAGGCGTTCAGCGTGTGGGCACCA[C/T]AGCAAAAGTTCACTCCGGCCTTTGTAAATAATTTGCTGTCTCACACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049572 Essential Splice Site 743 1419 18 35

The following transcripts of ENSDARG00000034773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20335886)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20860297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAAAATATAAATTTGATGATTTCAAGGATTATGTTTTTGTTTCACTT[A/T]GGGCGCCGGTTGTTTCAGTAACAATGACCTGCCATATTTTGAGCGTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049572 Nonsense 881 1419 21 35

The following transcripts of ENSDARG00000034773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20332804)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20857215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGTGGGGAAGAGAATTTTCCTTCTGGTTCAGTCTATTCTAACACCCT[T/A]AGAGCATCCAGGTGAGTCAAWTCAACTTTTTACTGCTTCWGGATCTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049572 Nonsense 932 1419 23 35

The following transcripts of ENSDARG00000034773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20332435)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20856846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCATAGGAAAACTGTGTCTGCAGCATGAGGATCTGATGATGAAGTA[T/A]CTCCCTGTGTTTGCCCGTGAGCTGGAAGTGGGCACAGAGCTGGCCGTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049572 Nonsense 1412 1419 35 35

The following transcripts of ENSDARG00000034773 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 20323292)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20847703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGAAAACCGGTGCCTAGGCAGTGGAATGTTGAATCCCCTCTGGTACAA[A/T]AACAGAGAGCCAAGAAACGCCTGTAATACATGTTTTTTGTTTTGTTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Volumetric brain MRI: Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link