si:dkey-188i13.1

Ensembl ID:
ENSDARG00000034768
ZFIN ID:
ZDB-GENE-090313-207
Description:
Novel protein similar to vertebrate PHD finger protein 3 (PHF3) [Source:UniProtKB/TrEMBL;Acc:B8A483]
Human Orthologue:
PHF3
Human Description:
PHD finger protein 3 [Source:HGNC Symbol;Acc:8921]
Mouse Orthologue:
Phf3
Mouse Description:
PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42266 Nonsense Mutation detected in F1 DNA During 2017
sa42267 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043440 Nonsense 871 1691 9 15
ENSDART00000100352 Nonsense 871 1691 10 16
ENSDART00000121773   None 737 None 8
ENSDART00000126902   None 358 None 4
ENSDART00000141988   None 95 None 3
Genomic Location (Zv9):
Chromosome 13 (position 38063358)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37540170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTTGATGTTTTTGTTGGCAGACAATTGAAATGATTGAAAAAGAACAA[C/T]GAGAGGTAGAAAGACGCCCTATTACTAAAATCACTCATAAAGGGGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043440 Nonsense 1658 1691 15 15
ENSDART00000100352 Nonsense 1658 1691 16 16
ENSDART00000121773   None 737 None 8
ENSDART00000126902   None 358 None 4
ENSDART00000141988   None 95 None 3
Genomic Location (Zv9):
Chromosome 13 (position 38070214)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 37547026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACAGTCATAAAGAGCGCCACTCGAAAGATGAAAGGTACGAGAAACAT[C/T]GAGAACGACGGCACAGCAGCCATCATCGGGACAGAGACAAACACAGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link