tspan3a

Ensembl ID:
ENSDARG00000034753
ZFIN ID:
ZDB-GENE-030131-7787
Description:
tetraspanin 3 [Source:RefSeq peptide;Acc:NP_001020709]
Human Orthologue:
TSPAN3
Human Description:
tetraspanin 3 [Source:HGNC Symbol;Acc:17752]
Mouse Orthologue:
Tspan3
Mouse Description:
tetraspanin 3 Gene [Source:MGI Symbol;Acc:MGI:1928098]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18030 Nonsense Available for shipment Available now
sa984 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050230 Nonsense 41 253 2 7
ENSDART00000127783 Nonsense 41 253 2 8
ENSDART00000130854 Nonsense 41 260 2 8
Genomic Location:
Chromosome 18 (position 26853774)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCATTCTGTGCTATGTCGGGGCATATGTGTTCATCACATATGATGACTA[T/A]GACCATTTCTTTGAGGAYGTGTACACCCTGATCCCAGCTGTCGTCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050230 Essential Splice Site 195 253 5 7
ENSDART00000127783 Essential Splice Site 195 253 5 8
ENSDART00000130854 Essential Splice Site 195 260 5 8
Genomic Location:
Chromosome 18 (position 26858396)
KASP Assay ID:
554-0888.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAACTGCACTGGCTCCCTCTTGCACCCCGGAGACCTTTATCCTGAGG[T/A]AAGAAATAACRGCTGCTTTGTCAAGGCTGATTTTATTTGTGAAGGTTTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cia8hfnr