esyt1a

Ensembl ID:
ENSDARG00000034714
ZFIN ID:
ZDB-GENE-090311-55
Human Orthologue:
ESYT1
Human Description:
extended synaptotagmin-like protein 1 [Source:HGNC Symbol;Acc:29534]
Mouse Orthologue:
Esyt1
Mouse Description:
extended synaptotagmin-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344426]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24338 Nonsense Mutation detected in F1 DNA During 2014
sa24339 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11243 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032290 Nonsense 72 1079 1 31
ENSDART00000140463 Nonsense 72 901 1 25
Genomic Location:
Chromosome 23 (position 25595721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTATTTCGGCTTCAGTATCAGTGTAGTTCTGCTCGGGCTCCTGGTTTA[T/A]ATAGGATGGAAACACAGTCGCGATGGGAAAAAAGCGCGACTGCAGAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032290 Essential Splice Site 173 1079 3 31
ENSDART00000140463 Essential Splice Site 173 901 3 25
Genomic Location:
Chromosome 23 (position 25602656)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTCATCTGCAGACTCTAAGCTTCACTAAAGTTGACTTGGGTGACAGGG[T/C]AAACAAATTCGTTTGTGATCATCATAGAAAGACTTTATTTGCATATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032290 Essential Splice Site 1019 1079 28 31
ENSDART00000140463 None None 901 None 25
Genomic Location:
Chromosome 23 (position 25630643)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGACCAGTGTTAAAAAGAAAAGCCTCAAACCAGAGTTCAATGAGAT[G/A]TTAGTAGGAACRTTCATAAATYACTGTCTTTGNNCACAAGAGTGGAAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Systemic sclerosis: Identification of novel genetic markers associated with clinical phenotypes of systemic sclerosis through a genome-wide association strategy. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fxskkh2f