lmbrd2a

Ensembl ID:
ENSDARG00000034710
ZFIN ID:
ZDB-GENE-050417-32
Description:
LMBR1 domain containing 2a [Source:RefSeq peptide;Acc:NP_001017576]
Human Orthologue:
LMBRD2
Human Description:
LMBR1 domain containing 2 [Source:HGNC Symbol;Acc:25287]
Mouse Orthologue:
Lmbrd2
Mouse Description:
LMBR1 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2444173]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25289 Nonsense Mutation detected in F1 DNA During 2016
sa20342 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043643 Nonsense 180 389 6 9
ENSDART00000128736 Nonsense 181 694 5 18
Genomic Location (Zv9):
Chromosome 5 (position 8099405)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7699654
KASP Assay ID:
554-7491.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGCACATCTAACATTTCTTTAACTTAAACATGTTTTTTTTTTTAAAG[G/A]TATGGCTTGCGTACAATTGGCATCACTGCCGCTAACACCTGGGGTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043643   None 389 None 9
ENSDART00000128736 Essential Splice Site 436 694 9 18
Genomic Location (Zv9):
Chromosome 5 (position 8086302)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7712757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCTTCATTCAGCTCGCAGAGAGAGACTACAACTACGTTTACATAGAG[G/A]TGAAGAGAAACACACATGCAATGATGACAAAAGGCCAGTCAGAGTTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link