lmbrd2a

Ensembl ID:
ENSDARG00000034710
ZFIN ID:
ZDB-GENE-050417-32
Description:
LMBR1 domain containing 2a [Source:RefSeq peptide;Acc:NP_001017576]
Human Orthologue:
LMBRD2
Human Description:
LMBR1 domain containing 2 [Source:HGNC Symbol;Acc:25287]
Mouse Orthologue:
Lmbrd2
Mouse Description:
LMBR1 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2444173]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8172 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25289 Nonsense Mutation detected in F1 DNA During 2014
sa20342 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043643 Essential Splice Site 58 389 2 9
ENSDART00000128736 Essential Splice Site 58 694 1 18
Genomic Location:
Chromosome 5 (position 8104800)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCYTGTGCTTTCTCATTGTCTTCATTTTACCGCTGGAYGTTAGTACG[G/A]TGAGTCCTGCTRGATGACTGAAAACAAACTGAAGTAAAAAATCTACACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043643 Nonsense 180 389 6 9
ENSDART00000128736 Nonsense 181 694 5 18
Genomic Location:
Chromosome 5 (position 8099405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATGCACATCTAACATTTCTTTAACTTAAACATGTTTTTTTTTTTAAAG[G/A]TATGGCTTGCGTACAATTGGCATCACTGCCGCTAACACCTGGGGTTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043643 None None 389 None 9
ENSDART00000128736 Essential Splice Site 436 694 9 18
Genomic Location:
Chromosome 5 (position 8086302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCTTCATTCAGCTCGCAGAGAGAGACTACAACTACGTTTACATAGAG[G/A]TGAAGAGAAACACACATGCAATGATGACAAAAGGCCAGTCAGAGTTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5fynpba7