pvalb7

Ensembl ID:
ENSDARG00000034705
ZFIN ID:
ZDB-GENE-040718-285
Description:
Parvalbumin-7 [Source:UniProtKB/Swiss-Prot;Acc:Q804W2]
Human Orthologue:
PVALB
Human Description:
parvalbumin [Source:HGNC Symbol;Acc:9704]
Mouse Orthologue:
Pvalb
Mouse Description:
parvalbumin Gene [Source:MGI Symbol;Acc:MGI:97821]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24198 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040761 Nonsense 76 109 4 5
ENSDART00000129859 Nonsense 76 109 5 6
ENSDART00000131386 Nonsense 79 112 3 4
ENSDART00000132702 Nonsense 76 109 4 5
ENSDART00000136790   None 58 None 4
Genomic Location (Zv9):
Chromosome 22 (position 31745526)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29224604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCCTTCTCTTGGACAGGTTTGTGCTGAAGGGCTTTTCTGCAGATGGC[A/T]GAGATCTTACCGATAAGGAGACCAAAGCATTCCTCGCTGCTGCTGATAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link