mysm1

Ensembl ID:
ENSDARG00000034693
ZFIN ID:
ZDB-GENE-041014-28
Description:
Histone H2A deubiquitinase MYSM1 [Source:UniProtKB/Swiss-Prot;Acc:Q5RGA4]
Human Orthologue:
MYSM1
Human Description:
Myb-like, SWIRM and MPN domains 1 [Source:HGNC Symbol;Acc:29401]
Mouse Orthologue:
Mysm1
Mouse Description:
myb-like, SWIRM and MPN domains 1 Gene [Source:MGI Symbol;Acc:MGI:2444584]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36979 Nonsense Mutation detected in F1 DNA During 2017
sa31039 Nonsense Mutation detected in F1 DNA During 2017
sa36978 Nonsense Mutation detected in F1 DNA During 2017
sa36977 Nonsense Mutation detected in F1 DNA During 2017
sa36976 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044655 Nonsense 32 822 2 20
ENSDART00000125133 Nonsense 32 716 2 20
Genomic Location (Zv9):
Chromosome 20 (position 9298696)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9132965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTTTTTACAGTGACCTGAGCAGTGCTGAGATTCTCCAGGATCAGTA[T/A]TTACAGTCCGCATGGAGGACAAACAGCAGTGTACTGGTATACATACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31039
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044655 Nonsense 201 822 7 20
ENSDART00000125133 Nonsense 201 716 7 20
Genomic Location (Zv9):
Chromosome 20 (position 9293254)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9127523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACGATGAGGATGTCGATATTACAGATGACTTCAGCGACAGCGAGTTA[C/T]AGTCTAAAAAGCAGCCAGAACGCTCCGTTTCTCCAGACTGCAACCACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044655 Nonsense 292 822 8 20
ENSDART00000125133 Nonsense 292 716 8 20
Genomic Location (Zv9):
Chromosome 20 (position 9291325)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9125594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAGCATGAGCACAACTAGTTAATGTGATCTTTTACTCCAGATAAGTG[T/A]GAATCAGCTGAATGTCTGGAGGAAGAAGTTGAAGACCAAGAGGAGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044655 Nonsense 322 822 8 20
ENSDART00000125133 Nonsense 322 716 8 20
Genomic Location (Zv9):
Chromosome 20 (position 9291236)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9125505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGAGGATGAAGAGGAGGAGCTCAGAGCTCCCGAACAAGAGGTTGAAT[T/A]GGACTTGAACACAATTACTGAAGAGGAAAAGCAAGCTATCTCAGAATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044655 Essential Splice Site 716 822 None 20
ENSDART00000125133 Essential Splice Site 716 716 None 20
Genomic Location (Zv9):
Chromosome 20 (position 9276916)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9111185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGACAGGCTTTTTCGAAGAGATTCTTCACTGACTTGCCTGGAGAAGG[T/A]AAAGTTTCTAATTCATTTTTGACAAACCGGCTAATTAAATTGCTTGAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link