scel

Ensembl ID:
ENSDARG00000034677
ZFIN ID:
ZDB-GENE-030616-15
Description:
sciellin [Source:RefSeq peptide;Acc:NP_001005304]
Human Orthologue:
SCEL
Human Description:
sciellin [Source:HGNC Symbol;Acc:10573]
Mouse Orthologue:
Scel
Mouse Description:
sciellin Gene [Source:MGI Symbol;Acc:MGI:1891228]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13716 Essential Splice Site Available for shipment Available now
sa12635 Essential Splice Site Available for shipment Available now
sa21456 Essential Splice Site Available for shipment Available now
sa21457 Nonsense Available for shipment Available now
sa41387 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 177 572 10 29
ENSDART00000075926 Essential Splice Site 177 612 10 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17833107)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17309177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGYATTGAGGGTCTCTGTATRTCTCATTGCACATGTTATCTGTTCCTAAA[G/A]TGACTACAAAACAACAARACAAGAGGACAWCACTGTGAAGTCATCAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 266 572 15 29
ENSDART00000075926 Essential Splice Site 296 612 17 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17840017)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17316087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTTCTGCATTTGTATATTAAAATTCAACCTATCATTCTTTTTGTTTA[G/T]GCCAACTTCACCTGTCAAGACCACCACTAGGTACAGTTACAGCTAMCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21456
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 276 572 None 29
ENSDART00000075926 Essential Splice Site 306 612 None 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17840150)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17316220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTATAAAAAGTTGTCTACTCTTAGAACATTTAAACTATTTTAATTAC[A/T]GCATCAAAACCTTCACCAAGGAGGATGTTTCACCAGCTAAATCAACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Nonsense 302 572 17 29
ENSDART00000075926 Nonsense 332 612 19 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17840394)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17316464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGACTAAAATGTTGATCCCTATATATTTTTGTGTGTCTAAAGTGACTA[C/A]AAGACTGAAGTGGCTACTGTGAAGTCATCAAAGGACATCATTGATATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048548 Essential Splice Site 567 572 28 29
ENSDART00000075926 Essential Splice Site 607 612 31 32

The following transcripts of ENSDARG00000034677 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 17850276)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 17326346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTACCAGTGTGCGATTCACTGTGCAAGCTGCTTTGGTGTCACTAAGA[G/A]TAAGAAAACTCTATACAACTACATTTTTCAGTATTCTGAAACAAATAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link