celf3

Ensembl ID:
ENSDARG00000034668
ZFIN ID:
ZDB-GENE-000501-2
Description:
CUGBP Elav-like family member 3 [Source:UniProtKB/Swiss-Prot;Acc:Q9IBD1]
Human Orthologue:
CELF3
Human Description:
CUGBP, Elav-like family member 3 [Source:HGNC Symbol;Acc:11967]
Mouse Orthologue:
Celf3
Mouse Description:
VCUGBP, Elav-like family member 3 Gene [Source:MGI Symbol;Acc:MGI:1926034]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23445 Nonsense Mutation detected in F1 DNA During 2014
sa13256 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039629 Nonsense 43 452 2 14
Genomic Location:
Chromosome 19 (position 9499844)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGCAGTTCGGGAAGATCTACGAGCTTACGGTGATCAAGGACAAGTA[C/A]ACGGGAATGCACAAAGGTAATTAAACGAGATTGACGCGGCTCTATTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039629 Essential Splice Site 49 452 2 14
Genomic Location:
Chromosome 19 (position 9499826)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTACGAGCTTACGGTGATCAAGGACAAGTACACGGGAATGCACAAAGG[T/A]AATTAAACGAGATTGACGCGGCTCTATTGAGCGGACAGTCTCAAGGGGAK
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f182ypwp