fabp7b

Ensembl ID:
ENSDARG00000034650
ZFIN ID:
ZDB-GENE-040614-4
Description:
fatty acid-binding protein, brain [Source:RefSeq peptide;Acc:NP_999972]
Human Orthologue:
FABP7
Human Description:
fatty acid binding protein 7, brain [Source:HGNC Symbol;Acc:3562]
Mouse Orthologue:
Fabp7
Mouse Description:
fatty acid binding protein 7, brain Gene [Source:MGI Symbol;Acc:MGI:101916]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16180 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041229 Nonsense 55 132 2 4
Genomic Location:
Chromosome 20 (position 40401637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGACGCTCGTCATCTCGAAGGAGGGAGAAAAGGTGGTCATAAAAACA[C/T]AGAGTACCTTCAAGAACACCGAGATCTCATTCACACTGGNNNNNNNAAGAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w7u4g20l