nuf2

Ensembl ID:
ENSDARG00000034624
ZFIN ID:
ZDB-GENE-040426-1121
Description:
Kinetochore protein Nuf2 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZW63]
Human Orthologue:
NUF2
Human Description:
NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:14621]
Mouse Orthologue:
Nuf2
Mouse Description:
NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21824 Essential Splice Site Available for shipment Available now
sa17992 Essential Splice Site Available for shipment Available now
sa41747 Nonsense Mutation detected in F1 DNA During 2017
sa38816 Nonsense Mutation detected in F1 DNA During 2017
sa30655 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21823 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040812 Essential Splice Site 41 454 None 13
ENSDART00000133784 Essential Splice Site 41 150 None 5
ENSDART00000137121 Essential Splice Site 41 283 None 11
Genomic Location (Zv9):
Chromosome 11 (position 424840)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 411577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGAGTCTAAACATTTCACCAAGAATGACCTCACTCCGACTCCTAAGG[T/C]ATTATTCCTCTGTGTTATTCTCATCTCTCACTCAAGTGTGTACAATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040812 Essential Splice Site 92 454 3 13
ENSDART00000133784   None 150 None 5
ENSDART00000137121 Essential Splice Site 92 283 4 11
Genomic Location (Zv9):
Chromosome 11 (position 423031)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 409768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CSATGCTGTACGAGTCGTTTGCTCCAATCATGAGYRTTTACATGCGCATG[T/C]AAGAGTTTCTACTGACRTCTGTAGTGCTTTATTCAGCAYACATGAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040812 Nonsense 116 454 5 13
ENSDART00000133784   None 150 None 5
ENSDART00000137121 Nonsense 116 283 6 11
Genomic Location (Zv9):
Chromosome 11 (position 421414)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 408151
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATGCTGACCTGTTGTTGTTTTTTCCTTGACGTTTGACAGAGACGAAG[C/T]GAACAATCACTATACTCAGCGCAATCCAGAATTTCCTGCACTTCAGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040812 Nonsense 302 454 10 13
ENSDART00000133784 Nonsense 146 150 5 5
ENSDART00000137121   None 283 None 11
Genomic Location (Zv9):
Chromosome 11 (position 417798)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 404535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCAGGTGGAGGCAGAAATCCAGATCCTGCTCAAACAGCTGCAGGACT[T/A]GCAGAGCAGCATGAGCAAGACCAAACAGCGAAAAGAGGAGGTAAAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040812 Essential Splice Site 315 454 10 13
ENSDART00000133784   None 150 None 5
ENSDART00000137121   None 283 None 11
Genomic Location (Zv9):
Chromosome 11 (position 417756)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 404493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGACTTGCAGAGCAGCATGAGCAAGACCAAACAGCGAAAAGAGGAGG[T/C]AAAGCACCAACAGGCACACAGAAATACCCCAAAATAAAAGTCTGTCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040812 Nonsense 354 454 11 13
ENSDART00000133784   None 150 None 5
ENSDART00000137121   None 283 None 11
Genomic Location (Zv9):
Chromosome 11 (position 417174)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 403911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCCAGCTGAAGAGGGCGCTCACCATGAAACTCGACAAGGAGTCCAAA[C/T]AACAGATTCGTAGACAGAAGAAAAAAGAGGTGAAAGATCAGCAAGTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link