gpr143

Ensembl ID:
ENSDARG00000034572
ZFIN ID:
ZDB-GENE-040426-1476
Description:
G-protein coupled receptor 143 [Source:RefSeq peptide;Acc:NP_957116]
Human Orthologue:
GPR143
Human Description:
G protein-coupled receptor 143 [Source:HGNC Symbol;Acc:20145]
Mouse Orthologue:
Gpr143
Mouse Description:
G protein-coupled receptor 143 Gene [Source:MGI Symbol;Acc:MGI:107193]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11260 Nonsense Available for shipment Available now
sa17686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047080 Nonsense 404 412 12 12
ENSDART00000133864 Nonsense 185 193 4 4
ENSDART00000139555 None None 177 None 3
ENSDART00000047080 Nonsense 404 412 12 12
ENSDART00000133864 Nonsense 185 193 4 4
ENSDART00000139555 None None 177 None 3
Genomic Location:
Chromosome 9 (position 57096389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCCACATTTCCAGCGARCAGMGAGARTTTGAGGAGCTGAAGCGAAAC[G/T]GAGCATCGTGGGAGATTTCTACARGCTAAAGAKTCAGAAGAGTCATTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047080 Nonsense 404 412 12 12
ENSDART00000133864 Nonsense 185 193 4 4
ENSDART00000139555 None None 177 None 3
ENSDART00000047080 Nonsense 404 412 12 12
ENSDART00000133864 Nonsense 185 193 4 4
ENSDART00000139555 None None 177 None 3
Genomic Location:
Chromosome 9 (position 57096389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCCACATTTCCAGCGAACAGAGAGAGTTTGAGGAGCTGAAGCGAAAC[G/T]GAGCATCGTGGGAGATTTCTACARGCTAAAGAKTCAGAAGAGTCATTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3mufyy9v