fitm2

Ensembl ID:
ENSDARG00000034568
ZFIN ID:
ZDB-GENE-050508-5
Description:
Fat storage-inducing transmembrane protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q52KL1]
Human Orthologue:
FITM2
Human Description:
fat storage-inducing transmembrane protein 2 [Source:HGNC Symbol;Acc:16135]
Mouse Orthologue:
Fitm2
Mouse Description:
fat storage-inducing transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:2444508]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17319 Nonsense Available for shipment Available now
sa24343 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041833 Nonsense 25 252 1 2
Genomic Location:
Chromosome 23 (position 26085322)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTGGACAAATTGGTTWGTCTTTGGAGACAGCCTTRTACACRTATTTA[T/G]TTGCCGCATTTATTCTTTTGTATTTCGTTAGTWGGCTCGGTTTTGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041833 Nonsense 236 252 2 2
Genomic Location:
Chromosome 23 (position 26084483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACCTCTTGTGGGATATTGGGATGGTACATGACCTATAAGGTTTGGTA[T/A]CTGAAGCTTTTTTCTCCTGGTCTCCCTCCACAGCCGAAACAACATACTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Meta-analysis of genome-wide association studies identifies eight new loci for type 2 diabetes in east Asians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9d0po4q5