si:ch211-285n22.1

Ensembl ID:
ENSDARG00000034555
ZFIN ID:
ZDB-GENE-070912-290
Description:
Novel protein similar to human and mouse par-3 partitioning defective 3 homolog B (C. elegans) (PARD
Human Orthologue:
PARD3B
Human Description:
par-3 partitioning defective 3 homolog B (C. elegans) [Source:HGNC Symbol;Acc:14446]
Mouse Orthologue:
Pard3b
Mouse Description:
par-3 partitioning defective 3 homolog B (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1919301]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18025 Nonsense Available for shipment Available now
sa34592 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21451 Essential Splice Site Available for shipment Available now
sa14053 Nonsense Available for shipment Available now
sa11131 Nonsense Available for shipment Available now
sa27364 Nonsense Mutation detected in F1 DNA During 2017
sa15430 Nonsense Available for shipment Available now
sa6111 Nonsense Mutation detected in F1 DNA During 2017
sa16200 Nonsense Available for shipment Available now
sa25419 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Nonsense 33 1172 1 22
ENSDART00000131512 Nonsense 33 131 2 4
ENSDART00000137043 Nonsense 33 178 2 6
ENSDART00000137117   None 629 None 13
ENSDART00000144022   None 185 None 3
Genomic Location (Zv9):
Chromosome 9 (position 15483446)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15236011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAAGGATGGACAGTGCGKGATCTCATCCTGCAAGCCACACAGAGATA[T/A]AGAAAACTACTGGAGCWGGTGAGTTTAGTGATCTTATCAGATTTAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Essential Splice Site 161 1172 4 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043 Essential Splice Site 161 178 5 6
ENSDART00000137117   None 629 None 13
ENSDART00000144022   None 185 None 3
Genomic Location (Zv9):
Chromosome 9 (position 15316284)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15068849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCCCTTGGAGCTTCTCAGATGGAAGATATGAACAGCAGAGCGATGG[T/C]AAAACCAAACTCACCCATTCAGCCTCTCACATTTCAAACACCACATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Essential Splice Site 214 1172 6 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043   None 178 None 6
ENSDART00000137117 Essential Splice Site 37 629 2 13
ENSDART00000144022   None 185 None 3
Genomic Location (Zv9):
Chromosome 9 (position 15268767)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15021332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCTTTAGGAATACACGTGGTGCCGTATTGCTCCTCTCTCAGCGGAAG[G/A]TTAGTACAGCACATTTCCCATTTTTCCATATTCACACACACACAAAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Nonsense 236 1172 7 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043   None 178 None 6
ENSDART00000137117 Nonsense 59 629 3 13
ENSDART00000144022   None 185 None 3
Genomic Location (Zv9):
Chromosome 9 (position 15256362)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15008927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTCGAGGGGTGGAGGAGAACAGTCGCTCCAAACGGGAAGSCATCTTT[C/T]AGGACGATKAGTGTATCGTTAAAAYTAATGATACTGAATTAATGGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11131
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Nonsense 239 1172 7 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043   None 178 None 6
ENSDART00000137117 Nonsense 62 629 3 13
ENSDART00000144022   None 185 None 3
Genomic Location (Zv9):
Chromosome 9 (position 15256353)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15008918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTGGAGGAGAACAGTCGCTCCAAACGGGAAGGCATCTTTCAGGACGAT[G/T]AGTGTATCGTTAAAAYTAATGATACTGAATTAATGGACAAGTCTTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Nonsense 280 1172 8 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043   None 178 None 6
ENSDART00000137117 Nonsense 103 629 4 13
ENSDART00000144022   None 185 None 3
Genomic Location (Zv9):
Chromosome 9 (position 15252084)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 15004649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCATGCGTTCATCCATCGTTCGTTTAGAAGTGGTTCCGGTCTTTAAT[A/T]AAGAACGTTTTGAGAAGAGTGTGATCAGCCACCTGTTTAACCCAGAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Nonsense 858 1172 18 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043   None 178 None 6
ENSDART00000137117   None 629 None 13
ENSDART00000144022   None 185 None 3
Genomic Location (Zv9):
Chromosome 9 (position 15017108)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14769673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTTTCTATGCCCTCCCCTTCTCTGTCTCTCCTTTAGATTTGGAAAG[A/T]AAAAGGAAGAGAAGAGCAAGYCAGAGACAAAAGTGAATGCRTTGAARCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Nonsense 1041 1172 21 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043   None 178 None 6
ENSDART00000137117   None 629 None 13
ENSDART00000144022 Nonsense 55 185 2 3
Genomic Location (Zv9):
Chromosome 9 (position 14875463)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14628028
KASP Assay ID:
554-3943.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTACCAGATGCCGATGAGAAACCCTGACCCCAGACTGGCACCCCGCTA[T/G]GAGGACGTCGAGCGAMAGTATGCCTCCTTGCCCAGGTAACAAYATCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Nonsense 1047 1172 21 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043   None 178 None 6
ENSDART00000137117   None 629 None 13
ENSDART00000144022 Nonsense 61 185 2 3
Genomic Location (Zv9):
Chromosome 9 (position 14875447)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14628012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGAGAAACCCTGACCCCAGACTGGCACCCCGCTAKGAGGACGTYGAGCGA[C/T]AGTATGCCTCCTTGCCCAGGTAACARYATYCACTCATTAWTYCCACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061062 Nonsense 1054 1172 22 22
ENSDART00000131512   None 131 None 4
ENSDART00000137043   None 178 None 6
ENSDART00000137117   None 629 None 13
ENSDART00000144022 Nonsense 68 185 3 3
Genomic Location (Zv9):
Chromosome 9 (position 14845795)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 14598360
KASP Assay ID:
554-7370.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCTTCCTTCCCCTAACTATATTTCCTTCACTTTCACTCTCTTGCAGA[A/T]GAGCACCAGCTGACCCTAATGAGTATCCTGTGCAGCAGTGGTCAGCACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • AIDS progression: Genome-wide association study implicates PARD3B-based AIDS restriction. (View Study)
  • Autism: Individual common variants exert weak effects on the risk for autism spectrum disorderspi. (View Study)
  • Knee osteoarthritis: Genome-wide association scan identifies a prostaglandin-endoperoxide synthase 2 variant involved in risk of knee osteoarthritis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link