atp6v1al

Ensembl ID:
ENSDARG00000034534
ZFIN ID:
ZDB-GENE-040426-1143
Description:
V-type proton ATPase catalytic subunit A [Source:RefSeq peptide;Acc:NP_957429]
Human Orthologue:
ATP6V1A
Human Description:
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A [Source:HGNC Symbol;Acc:851]
Mouse Orthologue:
Atp6v1a
Mouse Description:
ATPase, H+ transporting, lysosomal V1 subunit A Gene [Source:MGI Symbol;Acc:MGI:1201780]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20406 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049003 Nonsense 40 617 3 15
Genomic Location (Zv9):
Chromosome 5 (position 25915519)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23742784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTCAATACAGTGGTGACGGCCTCCAGCATGGCAGGTGCAGCTATGTA[T/A]GAACTGGTTCGTGTCGGCCACAGTGAGCTGGTGGGAGAGATTATCCGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link