rab6ba

Ensembl ID:
ENSDARG00000034522
ZFIN ID:
ZDB-GENE-050809-136
Description:
ras-related protein Rab-6B [Source:RefSeq peptide;Acc:NP_001029351]
Human Orthologue:
RAB6B
Human Description:
RAB6B, member RAS oncogene family [Source:HGNC Symbol;Acc:14902]
Mouse Orthologue:
Rab6b
Mouse Description:
RAB6B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:107283]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2309 Nonsense F2 line generated During 2016
sa5753 Nonsense F2 line generated During 2016
sa14349 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2309
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049177 Nonsense 22 208 1 8
ENSDART00000127126 Nonsense 72 258 1 8
ENSDART00000049177 Nonsense 22 208 1 8
ENSDART00000127126 Nonsense 72 258 1 8
Genomic Location (Zv9):
Chromosome 6 (position 27375757)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27676968
KASP Assay ID:
554-3060.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACTTTGGAAACCCTTTAAGGAAATTCAAACTCGTCTTTCTTGGAGAG[C/T]AAAGCGGTGAGTGTCATAWTGGAATTTCCTAAGGAAGTTTTGATGATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5753
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049177 Nonsense 22 208 1 8
ENSDART00000127126 Nonsense 72 258 1 8
ENSDART00000049177 Nonsense 22 208 1 8
ENSDART00000127126 Nonsense 72 258 1 8
Genomic Location (Zv9):
Chromosome 6 (position 27375757)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27676968
KASP Assay ID:
554-3060.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACTTTGGAAACCCTTTAAGGAAATTCAAACTCGTCTTTCTTGGAGAG[C/T]AAAGCGGTGAGTGTCATAWTGGAATTTCCTAAGGAAGTTTTGATGATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049177 Nonsense 42 208 2 8
ENSDART00000127126 Nonsense 92 258 2 8
Genomic Location (Zv9):
Chromosome 6 (position 27483689)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 27784900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACWTCCCTGATCACACGCTTCATGTATGACAGCTTTGACAACACATA[T/A]CAGGTAGGCTGCTTGACGTCCTTGTCATTCCATCATTCGTAGAGCTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link