per2

Ensembl ID:
ENSDARG00000034503
ZFIN IDs:
ZDB-GENE-011220-2, ZDB-GENE-011220-2
Description:
period circadian protein homolog 2 [Source:RefSeq peptide;Acc:NP_878277]
Human Orthologue:
PER2
Human Description:
period homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:8846]
Mouse Orthologue:
Per2
Mouse Description:
period homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1195265]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33027 Nonsense Mutation detected in F1 DNA During 2017
sa25916 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039735 Nonsense 272 1394 5 28
ENSDART00000098004 Nonsense 272 1399 5 22
Genomic Location (Zv9):
Chromosome 2 (position 48457563)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48489227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGATATCTTCGCAGTGGCCGTGTCTCTCATCACTGGGAAGATCGTCTA[T/A]ATTTCAGACCAGGCCGCCTCCATCCTCAACTGCAAGCGGGACGTCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039735 Essential Splice Site 323 1394 5 28
ENSDART00000098004 Essential Splice Site 323 1399 5 22
Genomic Location (Zv9):
Chromosome 2 (position 48457408)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48489072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCACCACACCATACAGGCTGCCCTCATGGAGCATGTGCACTGGCGCAG[G/A]TAGAACACACACACACTGACAAATACACACTTACTCTATCACACACACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link