grin2aa

Ensembl ID:
ENSDARG00000034493
ZFIN ID:
ZDB-GENE-070424-129
Description:
Novel protein similar to vertebrate glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A)
Human Orthologue:
GRIN2A
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2A [Source:HGNC Symbol;Acc:4585]
Mouse Orthologue:
Grin2a
Mouse Description:
glutamate receptor, ionotropic, NMDA2A (epsilon 1) Gene [Source:MGI Symbol;Acc:MGI:95820]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13836 Nonsense Available for shipment Available now
sa14573 Nonsense Available for shipment Available now
sa8122 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073979 Nonsense 58 1460 1 12
ENSDART00000142141 None None 1325 None 11
Genomic Location:
Chromosome 3 (position 27225743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTCARACTCGCTACATCTCTGACAGAGATATACGGGCTCTGTGGAGC[A/T]AAGATGATCCTATTGATGTCAATGTGGTGACCCTGCTGGTGAATGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073979 Nonsense 345 1460 3 12
ENSDART00000142141 Nonsense 210 1325 2 11
Genomic Location:
Chromosome 3 (position 27358238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCTTCCTGTAGGTACATGATGAACGTGACCTGGGATGGCAAGGATT[T/A]GTYCTTCACCGAGGACGGTTACCAGGTGCWTCCMAAACTAGTGGTGATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073979 Nonsense 734 1460 10 12
ENSDART00000142141 Nonsense 599 1325 9 11
Genomic Location:
Chromosome 3 (position 27419016)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCCCAGCAAACTTGAWGCCTTCATTTATGATGCTGCTGTGCTRAACTA[T/A]ATGGCTGGTAGAGACGAGGGTTGTAAATTGGTGACCATTGGAAGTGGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/crq17j91