LOC556314

Ensembl ID:
ENSDARG00000034473
Human Orthologue:
TTYH3
Human Description:
tweety homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:22222]
Mouse Orthologue:
Ttyh3
Mouse Description:
tweety homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925589]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12909 Nonsense Available for shipment Available now
sa12669 Essential Splice Site Available for shipment Available now
sa10623 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083111 Nonsense 208 525 4 14
Genomic Location:
Chromosome 3 (position 42027209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCGGCGTCTCCCTGGAGGATCTGGCAACCCAGATTGAGMTGTATGACT[G/A]GTACAGGTACGTCAMGAGAAGCGAGGTATTGGTGAAACACCTGCTTCWAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083111 Essential Splice Site 341 525 9 14
Genomic Location:
Chromosome 3 (position 41990043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTGTCTGAACTACTGCGTTCTGCAGTCAGAGAATACCCCAAAACAAAG[G/A]WGAGTGYTTGTTTACAGGTCTCTACGTGTTTGTCTATGTGATTCATAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083111 Essential Splice Site 341 525 9 14
Genomic Location:
Chromosome 3 (position 41990042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGTCTGAACTACTGCGTTCTGCAGTCAGAGAATACCCCAAAACAAAGG[T/A]GAGTGYTTGTTTACAGGTCTCTACGTGTTTGTCTATGTGATTCATAGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o0g4tx95