aldoab

Ensembl ID:
ENSDARG00000034470
ZFIN ID:
ZDB-GENE-040426-2299
Description:
aldolase a, fructose-bisphosphate, b [Source:RefSeq peptide;Acc:NP_998380]
Human Orthologue:
ALDOA
Human Description:
aldolase A, fructose-bisphosphate [Source:HGNC Symbol;Acc:414]
Mouse Orthologues:
Aldoa, Aldoart1, Aldoart2
Mouse Descriptions:
aldolase 1 A retrogene 1 Gene [Source:MGI Symbol;Acc:MGI:2447811]
aldolase 1 A retrogene 2 Gene [Source:MGI Symbol;Acc:MGI:1931052]
aldolase A, fructose-bisphosphate Gene [Source:MGI Symbol;Acc:MGI:87994]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4446 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22002 Essential Splice Site Available for shipment Available now
sa22001 Nonsense Mutation detected in F1 DNA During 2014
sa19021 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042200 Essential Splice Site 181 364 5 7
ENSDART00000042200 Essential Splice Site 181 364 5 7
Genomic Location:
Chromosome 12 (position 4738451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACAGTGTGTCAGATGAATYATTTATATTCATTTCTGTTGCTGTGGTC[A/T]GCATGGTATTGTACCCATCGTGGAGCCTGAGATCCTGCCTGATGGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042200 Essential Splice Site 181 364 5 7
ENSDART00000042200 Essential Splice Site 181 364 5 7
Genomic Location:
Chromosome 12 (position 4738451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACAGTGTGTCAGATGAATCATTTATATTCATTTCTGTTGCTGTGGTC[A/G]GCATGGTATTGTACCCATCGTGGAGCCTGAGATCCTGCCTGATGGTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042200 Nonsense 223 364 5 7
Genomic Location:
Chromosome 12 (position 4738321)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGGTTCTGGCAGCGGTGTACAAGGCTCTTTCAGACCATCATGTGTA[T/G]CTGGAGGGAACCCTGCTGAAGCCCAACATGGTGACGGCCGGTCACTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042200 Nonsense 302 364 6 7
Genomic Location:
Chromosome 12 (position 4737620)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATCAACCAGTGTCCGCTGAGCAAACCCTGGGCCCTCACCTTCTCCTA[C/A]GGACGGGCCCTGCAGGCCTCCGCTCTTAAAGCCTGGGGAGGAAAGAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oecza6o3